Identification of some microorganisms directly from clinical sample by multiplex PCR

Introduction

Infectious diseases are among the most common diseases affecting human beings and are among the main causes of morbidity and mortality in developed and developing countries 1, 2. Infectious diseases can progress quickly and endanger patients’ lives.

According to a study done that includes data obtained from 15 centers examining hospital infections in our country in Turkey; the causative agent of 30-72% of hospital infections is gram-negative bacteria According to a study obtained from 15 health centers in Turkey and including hospital infection data ;30-72% of hospital infections were caused by gram negative bacteria 3.

These bacteria are the most important causes of hospital and community acquired infections 4 including nosocomial bloodstream infections, especially when the source of bloodstream infections is urinary, respiratory or gastrointestinal tract 5.

Gram-negative bacteria play an important role in the development of bacteremia and sepsis in terms of both their endotoxin production properties and their resistance development 6.

Bloodstream infections are one of the most common invasive infections and can cause mortality and morbidity 7,8.

Therefore, timely implementation of effective treatment in sepsis patients is crucial for a patient's prognosis. However, in recent years, the effectiveness of empirical treatments has seen a decline due to the spread of resistant bacteria 9. Prolonged use of broad-spectrum antibiotics in empirical treatments has also contributed to antibiotic resistance worldwide 10,11.Early diagnosis and treatment of bloodstream infections are very effective in reducing mortality rates.

Blood culture is an important diagnostic method used to isolate microorganisms that cause sepsis and bacteremia and to initiate appropriate antimicrobial therapy 12-14. Detection of microorganisms in a patient's blood is extremely important not only for diagnosis but also for the treatment and prognosis of the patient. 15. However, traditionally, identification of pathogens causing bloodstream infection in blood culture and application of antibiotic susceptibility tests is a time-consuming method as it involves multiple incubation steps.

It is crucial that microorganisms isolated in blood cultures should be diagnosed and reported to the clinician in a short time, and antibiotic treatment should be initiated as soon as possible 16. Speeding up laboratory examinations, informing clinicians about the initial possible results and helping guide the treatment process are amongst the other important actions 17.

Mortality rate of patients with positive blood cultures has been reported to be 12 times higher than that of those without growth in blood cultures 16. This shows the urgent need for a rapid and reliable diagnostic method which would allow clinicians make faster and more informed treatment choices for these patients.

With the recent development of new methods and advances in the diagnosis of sepsis, it has become possible for clinicians to obtain faster and more reliable results than they did with conventional methods 18,19. In particular, identification and antibiotic susceptibility testing directly from a positive blood culture bottle has the potential to further reduce the time from empirical therapy to optimal therapy.

More recently, molecular techniques have been developed to provide faster diagnosis of bacterial infection by detecting bacterial DNA in blood. It should be noted that molecular methods complement traditional culture, antigen and antibody-based methods for the epidemiological analysis, identification and identification of infectious microorganisms.

Early diagnosis of bacterial infections has a significant impact on the effectiveness of a patient treatment process. A faster and more sensitive method for bacterial DNA and bacterial species differentiation and identification will allow earlier treatment with a specific antibiotic. Moreover, rapid bacterial identification could effectively lead to saving of hospital resources and reduced hospital stays and thereby costs 20.

The aim of our study was to develop a method for the diagnosis of some gram-negative bacteria, which are most commonly could be isolated directly from the clinical sample (blood culture bottle).

Material and Method

Bacterial strains

The strains selected as positive controls in our study were Acinetobacter baumannii (ATCC 19606), Escherichia coli (ATCC 25922), Serratia marcescens (ATCC 13880) and Pseudomonas aeruginosa (ATCC 27853). Bacteria stored in lyophilized form at -20°C were passaged on 5% sheep blood agar and EMB agar and were grown in an oven at 37°C. The samples were passaged twice to obtain pure bacterial strains.

Primers

The chosen primer set targets a highly conserved area.

1. baumannii

(5'CATGGACATAAGCCTGT TC-3', 3'CCCGAGGCATAGACTGTA-5'),

E.coli

(5' TCA CCC GCT TGC GTG GC 3', 3' GGAACTGGAACTCACAAAC 5'),

P. aeruginosa

(5' GGGGGATCTTCGGACCTC) 3', 3' TCCTTAGAGTGCCCCACCCG 5'),

S. marcescens

(5'GGGAGCTTGCTCCCCGG3', 3'AACGTCAATTGATGAACGTATTAAGT 5').

Colony PCR and Blood Culture Obtaining

A visible piece was taken from the colony to be tested with the help of a loop and dissolved in approximately 50 µl of sterile water. Plasmids were removed from the exploded cells by keeping them in boiling water for 10 minutes. Bacterial residues were precipitated by a brief centrifugation. PCR reaction was established by taking 0.5-1 µl from the upper aqueous portion. The formation of the expected bands was determined after agarose gel electrophoresis.

Then, in our study, an experimental blood culture medium was created. For this, Karakoç et al. (2009)'s experiments were modified and followed 21. The study was carried out in two stages. In the first stage, microorganisms (ATCC strains) incubated for 24 hours on 5% sheep blood agar and EMB agar to obtain the logarithmic phase of growth were suspended in LB (Luria-Bertani) broth using the appropriate 0.5 McFarland (1x108) 22 standard.

In the second stage, the suspensions were diluted to obtain 106 microorganisms per mL before inoculation into blood culture bottles. After the prepared suspension was added to the bottle, 1-5 ml of blood was inoculated into blood culture bottles and was grown in an oven at 37°C. Hemoculture samples were evaluated in manual biphasic blood culture systems showing growth signal. Turbidity in the bottle and growth on the agar surface were considered positive growth. Subculture and staining results with the experimentally inoculated microorganism into the blood culture bottle were examined for possible contamination. To test the accuracy, the samples in the blood culture bottles were passaged to 5% sheep blood agar and EMB agar and grown in an oven at 37°C.

DNA extraction

The DNA extraction method of Angeline (2006), one of the blood cultures with positive growth, was modified and applied in our study 23. 1 ml of blood culture was taken with sterile ependorfe and centrifuged at 4000 rpm for 5 minutes to precipitate erythrocytes.

The supernatant was taken separately and centrifuged at 15000 rpm for 3 minutes. The supernatant was discarded. The pellet was washed 1-2 times with sterile water. 150 µl of TE (pH:8) was added to the pellet. It was vortexed. It was boiled at 100ºC for 15 minutes. It was immediately brought to -20ºC. After waiting for 15 minutes, spin was done at 10000 rpm for 10-12 seconds. The resulting sample was used as a template in PCR.

Monoplex and Multiplex PCR

First, monoplex PCR experiments were performed and images were obtained, and then multiplex PCR experiments were performed. For multiplex PCR, a set of 4 was prepared considering the product sizes and primers (Table 1). A. baumannii, E. coli, S. marcescens and P. aeruginosa, which are frequently isolated in blood cultures, were matched (Table 2).

As a result of optimization studies, experimental conditions and tube concentration were adjusted.

Gel Electrophoresis

PCR products were visualized by running in 1% agarose gel. To this end, 1 g of agarose was dissolved in 100 ml of 1X TAE buffer using a microwave oven. Completely dissolved agarose was cooled to 45-50ºC and 1.5 μl (10 μg/ml) ethidium bromide was added. It was mixed well and poured into a horizontal electrophoresis cassette with a thickness of 5 mm, and then it was left to cool. Combs were removed from the frozen gel and wells were formed. 1/5 of the PCR products were taken and mixed with 6X loading dye, which was loaded into the wells.

The gel was run at 110 milliamperes (mA) in TAE buffer (1X Tris-Acetate-EDTA (Ethylene diamine tetra acetic acid)), and then it was taken on the transilluminator and photographed. The molecular weight of the amplified DNA was determined by the molecular weight standard (100 bp plus ) and its accuracy was determined

Results

In PCR, monoplex PCR was performed by using DNA obtained from colony and blood culture by boiling method as a template. DNA obtained by bacterial culture from ATCC strains and genomic DNA isolation was used as a template in monoplex PCR, using different primer, MgCl2 and dNTP concentrations, as well as different reaction conditions such as number of cycles, primer attachment temperature (annealing temperature) and duration. The most ideal conditions were determined as 36 cycles and 50°C bonding temperature.

The study went on to perform colony PCR. Gram-stained strains with gram-negative growth detected by inoculation of various clinical samples were used as templates in PCR.

After colony PCR, the identification from direct blood culture was performed. Biphasic blood culture bottles were examined for the presence of gram-negative bacteria by performing gram staining after the positive signal. The samples, in which the presence of gram-negative bacteria was detected, were separated as bacillus and cocci or coccobacillus this time. They were extracted by boiling method and used as a mold in PCR.

The study continued with 146 blood culture positive clinical samples with gram negative bacteria in gram staining and blood culture negative clinical samples.

In the optimization of multiplex-PCR, different primer, MgCl2, dNTP concentrations and different reaction conditions such as cycle number, primer attachment temperature and time were used. The most appropriate conditions were again determined as 36 cycles and 50°C bonding temperature.

Desired bands were obtained in all of the clinical samples studied. The confirmation was carried out by passage into the medium.

Negative samples were found to be negative.

The bands obtained as a result of PCR experiments were checked for expected product size. Fermentas 100 bp plus was used as the molecular weight standard. Images obtained by multiplex PCR experiments are presented below:

Figure 1. UV transluminator image of multiplex PCR products with primers specific for PA, SM, EC, AB from direct blood culture after electrophoresis on agarose gel (1%) (M. Molecular weight standard, 1. Multiplex PCR (PC) 2-3-4 -5. DNA templates obtained by extraction from direct blood culture (PA. P. aeruginosa (956 bp), SM. S. marcescens (452 bp), EC. E. coli (296 bp)), AB. A. baumanni i( 160 bp), 6. Negative control (NC)

In this study, first, experimental blood culture positivity studies were followed with a pilot study on twenty clinical samples. Then, 146 positive and 40 negative samples were collected and examined. The results of blood culture and multiplex PCR test method were compared. According to the results of all tests applied, all positive samples were found to be positive and all negative samples were found to be negative.

Discussion

Infectious diseases are diseases that progress quickly and can endanger the life of a patient a short time. It is therefore important to speed up laboratory investigations as much as possible. Effective management of infectious diseases depends on the correct and rapid identification of the causative microorganism.

Invasion of the circulatory system by microorganisms is one of the most serious conditions in infectious diseases 17,24 and is reported to be one of the main causes of morbidity and mortality 24,25. Thus, it requires a complete and adequate treatment strategy 26.

The detection of microorganisms present in positive blood culture bottles reduces empirical antibiotic therapy adaptation, thereby reducing patient exposure to ineffective or unnecessary antibiotics 26.

Cultivation is the gold standard 27-31 for identifying microorganisms present in the bloodstream, however, this technique is quite slow because it takes one or more days to obtain results 32,33. Molecular-based studies such as PCR offer solutions to studies such as culture 34.

In some molecular-based studies, the identification of microorganisms by PCR requires a period of five hours 35, 36. The findings from our study show shorter duration and reduced costs compared to these studies, which is an advantage.

The study period of Trung et al. is similar to that in our study, but a limitation of this study is that it did not yield results at low DNA levels 37.

Conclusion

In conclusion, in the diagnosis of infectious diseases, isolation from blood is the most valuable method in the definitive diagnosis of bacteremia-causing diseases and in the regulation of the treatment. Various pathogens have different antibiotic sensitivities, and successful treatment depends on prompt administration of appropriate drugs. Rapid and accurate detection of pathogens is also essential. Inadequate antibiotic treatment is associated with higher mortality rates, emergence of antibiotic resistance, and prolonged hospital stays 26.

Our study has advantages such as low cost, specific primers, requiring less time such as 3-4 hours, and identification of the four gram-negative bacteria most frequently isolated in clinical samples in a PCR tube, based on multiplex PCR-based work.

In addition, the isolation of the DNA of microorganisms with the boiling method we used in the research here has the least detailed difficulty. Compared to other methods 36, it requires fewer steps and materials, does not contain toxic materials, requires low skill levels. Also, since all process takes place in the same tube in our study, the amount of waste and the possibility of contamination is minimized. The chemicals used do not require special use, let alone the biohazard use system.

In our future work, In addition to our specified bacterial identification kit, we aim to further develop our kit by determining different antibiotic resistances in these organisms with the help of multiplex PCR.

Conflict of interest

No conflict of interest is declared.

References

1. Jarvis WR. Selected aspects of the socioeconomic impact of nosocomial infections: Morbidity, mortality, cost and prevention. Infect Control Hosp Epidemiol. 1996 Aug; 17: 552-57.

2. Öztürk R. Tanı yöntemlerindeki gelişmelerin infeksiyon hastalıkları kliniğine yansıması. ANKEM Dergisi 2005 May; 19 (2): 8-13.

3. Eraç B, 2006. Hastane kökenli gram-negatif bakterilerde per-1 enziminin moleküler epidemiyolojisi. PhD, Dokuz Eylül Üniversitesi, İzmir, Türkiye, 2006.

4. Kuyucu N. Çocuklarda dirençli gram negatif bakteri enfeksiyonları ve tedavisi. Çocuk Enf Dergisi 2009 May; 3 (Special Issue 1): 70-4.

5. Rodríguez-Baño J, Navarro MD, Romero L, Muniain MA, de Cueto M, Gálvez J et al. Risk-factors for emerging bloodstream infections caused by extended-spectrum β-lactamase-producing Escherichia coli. Clin Micro-biol Infect. 2008 Nov 15; 14:180-3.

6. Küçükbasmacı Ö, Çalışkan AR, Hamança Ö, Çelik Ş, Köksal F, Gönüllü N, Saması M. Kan örneklerinden üretilen Gram negatif çomakların antibiyotiklere duyarlılıkları. Türk Mikrobiyol Cem Dergisi 2007 Dec; 37: 201–3.

7. Er H, Aşık G, Yoldaş Ö, Demir C, Keşli R. Kan kültürlerinde izole edilerek tanımlanan mikroorganizmaların ve antibiyotik direnç oranlarının belirlenmesi. Türk Mikrobiyol Cem Derg. 2015 Nov; 45(1):48-54.

8. Yüksekkaya Ş, Opuş A, Güvenç Hİ ve ark. 2009- 2013 yılları arasında Konya Eğitim ve Araştırma Hastanesi’nde kan kültüründen izole edilen Staphylococcus aureus suşlarının antimikrobiyal ajanlara duyarlılıklarının değerlendirilmesi. ANKEM Derg. 2017;31(1):1-6 ).

9. Berinson B, Both A, Berneking L, Christner M, Lütgehetmann M, Aepfelbacher M, Rohde H. Usefulness of biofire filmarray BCID2 for blood culture processing in clinical practice. J Clin Microbiol 2021 Aug; 59:8.

10. Claeys KC, Heil EL, Hitchcock S, Johnson JK, Leekha S. management of gram-negative bloodstream ınfections in the era of rapid diagnostic testing: ımpact with and without antibiotic stewardship. Open Forum Infect Dis, 2020 Oct; 7 (10): 1-8.

11. Teshome BF, Vouri SM, Hampton N, Kollef MH, Micek ST. Duration of exposure to antıpseudomonal antibiotics in the critically ill and development of new resitance, Pharmacotherapy 2019 Mar; 39(3):261-270.

12. Yüce P, Demirdağ K, Kalkan A, Özden M, Denk A, Kılıç SS. Kan kültürlerinde izole edilen mikroorganizmalar ve antibiyotik duyarlılıkları, ANKEM Derg 2005 April; 19: 17–21.

13. Gaibani P, Rossini G, Ambretti S, Gelsomino F, Pierro AM, Varani S, et all. Blood culture systems: rapid detection – how and why? International Journal of Antimicrobial Agents 2009; 34:13-15.

14. Mancini N, Carletti S, Ghidoli N, Cichero P, Burioni R, Clementi M. The era of molecular and other non-culture-based methods in diagnosis of sepsis. Clin Microbiol Rev. 2010 Jan; 23:235–251.

15. Düzenli G, Karabay O. Kan kültürlerin düşük maliyetli ve hızlı ölçülebilmesi için yeni bir yaklaşım. Gazi Üniv. Müh. Mim. Fak. Dergisi 2014 Sep; 29 (3): 617-624.

16. Yang L, Lin Y, Wang J, Song J, Wei B, Zhang X, Yang J, Liu B. Comparison of Clinical Characteristics and Outcomes Between Positive and Negative Blood Culture Septic Patients: A Retrospective Cohort Study. Infection and Drug Resistance 2021 Oct; 14 4191–4205.

17. Müderris T, Yurtsever SG, Baran N, Özdemir R, Er H, Güngör S, Gökmen AA, Kaya S. Kan kültürlerinde izole edilen mikroorganizmalar ve antimikrobiyal duyarlılık paternlerinin son beş yıldaki değişimi. Turk Hij Den Biyol Derg. 2019 Sep; 76(3): 231- 242.

18. . D. Gonzalez, T. Chao, and M. A. Pettengill, “Modern Blood Culture Management Decisions and Method Options,” Clin Lab Med, vol. 40, no. 4, p. 379, 2020, doi: 10.1016/j.cll.2020.07.001.

19. B. Lamy, M. Sundqvist, and E. A. Idelevich, “Bloodstream infections – Standard and progress in pathogen diagnostics,” Clinical Microbiology and Infection, vol. 26, no. 2, pp. 142–150, Feb. 2020, doi: 10.1016/j.cmi.2019.11.017.)

20. Ovia ̃no M. Rapid identification of microorganisms directly from positive blood cultures by MALDI-TOF MS. Enferm Infecc Microbiol Clin. 2019 May; 37(5):287–289.

21. Karakoç AE, Tanju V, Yücel M. Mikroorganizma konsantrasyonu-pozitif sonuç ilişkisi ile bir kan kültür sisteminin validasyonu. Flora 2009 Sep; 14(3):105-112.

22. Çağlayan P. Aktif içeriği Sodyum Dimetilditiyokarbamat Olan Antimikrobiyal

Maddenin Antibiyotiklere Dirençli Referans Bakteri Suşlarına Karşı Minimum İnhibitör Konsantrasyonlarının Araştırılması. Marmara Fen Bilimleri Dergisi 2018 Dec 31; 4: 415-421.

23. Angelina WSL. Broad-Range PCR Amplification Of bacterial DNA in Various Clinical Samples fort he Rapid Diagnosis of Infections. PhD, University of Malaya, Kuala Lumpur, Malaysia, 2006.

24. Fujita S, Yosizaki K, Ogushi T, Uechi K, Takemori Y, Senda Y. Rapid identification of gram-negative bacteria with and without CTX-M extended-spectrum β-lactamase from positive blood culture bottles by PCR followed by microchip gel electrophoresis. J Clin Microbiol. 2011 Apr; 49: 1483-8.

25. Hattori H, Maeda M, Nagatomo Y, Takuma T, Niki Y, Naito Y, Sasaki T, Ishino K. Epidemiology and risk factors for mortality in bloodstream infections: A single-center retrospective study in Japan. American Journal of Infection Control. 2018 Dec; 46 (12): 75-79.

26. Hansen WL, Beuving J, Bruggeman CA, Wolffs PF. Molecular probes for the diagnosis of clinically relevant bacterial infections in blood cultures. J. Clin. Microbiol. 2010 Dec; 48, 4432-4432.

27. Barenfanger J, Graham DR, Lavanya K, Callahan CD. et all. Decreased mortality associated with prompt gram staining of blood cultures. Am J Clin Pathol. 2008 Jan; 130:870-876.

28. Jordan JA, Jones-Laughner J, Durso MB. Utility of pyrosequencing in identifying bacteria directly from positive blood culture bottles. J. Clin. Microbiol. 2009 Feb; 47: 368–372.

29. Kirn TJ, Weinstein MP. Update on blood cultures: how to obtain, process, report, and interpret. Clin Microbiol Infect. 2013 Jun; 19(6):513-20.

30. Loonen AJM, de Jager CPC., Tosserams J, Kusters R, Hilbink M, Wever PC, Brule AJC. Biomarkers and molecular analysis to improve bloodstream ınfection diagnostics in an emergency care unit. PLOS ONE; 2014 Jan; 9(1).

31. Choi EC, Chia YH, Koh YQ, Lim CZQ, Lim JC, Ooi SBS, Ibrahim I, Kuan WS. Appropriateness of blood culture: a comparison of practices between the emergency department and general wards. Infect Dis Health. 2019 Feb; 24(1): 49-55.

32. Arabestani MR, Fazzeli H, Nasr Esfahani B. Identification of the most common pathogenic bacteria in patients with suspected sepsis by multiplex PCR. J Infect Dev Ctries. 2014 Feb; 8:461-468.

33. Nestor D, Andersson H, Kihlberg P, Olson S, Ziegler I. Rasmussen G. Källman J, Cajander S, Mölling, P, Sundqvist M. Early prediction of blood stream infection in a prospectively collected cohort. BMC Infectious Diseases 2021 Apr; 21:316.

34. Bloos F, Sachse S , Kortgen A, Pletz MW , Lehmann M, Straube E, Riedemann NC, Reinhart K, Bauer M. Evaluation of a Polymerase Chain Reaction Assay for Pathogen Detection in Septic Patients under Routine Condition: An Observational Study PLOS ONE, 2012 Sept;7: 9.

35. Arabestani MR, Fazzeli H, Esfahani BN. Identification of the most common pathogenic bacteria in patients with suspected sepsis by multiplex PCR. J Infect Dev Ctries 2014 Apr; 8(4):461-468.

36. Loonen AJM, de Jager CPC, Tosserams J, Kusters R, Hilbink M, et al.Biomarkers and Molecular Analysis to Improve Bloodstream Infection Diagnostics in an Emergency Care Unit PLOS ONE 2014 Jan; e 9: 1.

37. Trung NT, Thu Hien TT, Thanh Huyen TT, Quyen DT, Son TV, Hoan PQ, Phuong NTK, Lien TT, Binh MT, Tong HV, Meyer CG, Velavan TP, Song LH. Enrichment of bacterial DNA for the diagnosis of blood stream infections. BMC Infectious Diseases 2016 May; 16:235.